Phee401e vector
WebDec 19, 2024 · To construct pHEE401E (Wang et al., 2015) vectors targeting four different sites of PAR1 and one site of JAZ1 or GAI, the dsDNA was fused to the BsaI-digested … WebAug 16, 2024 · Building on the pHEE401E plasmid, a Cambia T-DNA adapted for 96 genome editing with CRISPR/Cas9 nucleases (Wang & al., 2015), we created a series of 97 vectors enabling selection and counter-selection of transgenics on the basis of seed 98 fluorescence. Toward this end, we replaced the hygromycin resistance marker of pHEE401E
Phee401e vector
Did you know?
WebModified from the pHEE401E T-DNA vector described by Wang &al. (2015) Genome Biol 16: 144, doi:10.1186/s13059-015-0715-0: the Hygromycin selection maker of the T-DNA was exchanged with a cassette enabling selection on the basis of CFP-fluorescence in seeds; the egg-cell specific promoter of Cas9 was exchanged with a ubiquitin promoter. WebMar 15, 2024 · Then the fragment was ligated into the binary vector pHEE401E by the restriction-ligation system ( Wang et al., 2015 ). Then, the recombinant plasmid pHEE401E-2sgRNA-SlNAC063 was transformed into wild-type tomato AC using the stable A. tumefaciens -mediated transformation method ( McCormick et al., 1986; Gupta and Van …
WebApr 22, 2024 · After immunoprecipitation (IP) with anti-FLAG agarose, ubiquitinated BIK1 was detected by immunoblot (IB) using anti-HA antibodies (lanes 1 and 2) or treated with GST–USP2-cc (lane 3).... WebAug 13, 2024 · EAR (Ethylene-responsive element binding factor-associated Amphiphilic Repression) motif-containing transcription repressors have been shown to regulate plant growth and development, and plant responses to plant hormones and environmental stresses including biotic and abiotic stresses. However, the functions of most EAR-motif …
WebThe construct is split into one module vector set (pCBC-DT1T2) containing two single guide RNAs (sgRNAs) and a binary vector based on pCAMBIA (pHEE401E) containing additional … WebJul 24, 2024 · By Gibson Assembly, this element was ligated into the pHEE401E binary vector (Wang et al., 2015) digested by restriction endonuclease BsaI. We added the BsaI restriction site to the GL2-2Tar-F/R primers, so the final vector still retained the BsaI cutting site, allowing for the insertion of sgRNAs for target loci of interest.
WebApr 13, 2024 · To generate mutants of npf8.4-2 and npf8.4-3, two single guide RNAs (AGTTCCGGGTCTTAAGCCAG and GAGATGCAAACACTAACCCG; Genomics Inc.) targeting NPF8.4 were inserted into the binary vector pHEE401E ...
WebName. pHEE401E. Type. plasmid. Tair Accession. Vector:6531224345. Description. CRISPR/Cas9 vector with maize codon-optimized Cas9 between egg cell-specific enhancer/promoter combination (EC1.2en/EC1.1p) and rbcS-E9 terminator. Host Strain. infant newborn careWebNov 22, 2024 · The pHEE401E vector has a type IIS restriction-enzyme-recognition site for ligation [6]. The other is a pBAtC-tRNA vector that uses a polycistronic tRNA-gRNA … infant newborn baby toysWebpHEE401E (Plasmid #71287) Print Enlarge View all sequences Purpose Egg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for … Plasmid pHEE401 from Dr. Qi-Jun Chen's lab contains the inserts sgRNA scaffold … Plasmid pCBC-DT1T2 from Dr. Qi-Jun Chen's lab contains the insert T1, U626t … infant newborn blood sugarWebApr 18, 2015 · /dnas_title="pHEE401E" ORIGIN : 1 gtttacccgc caatatatcc tgtcaaacac tgatagttta aactgaaggc gggaaacgac: 61 aatctgatcc aagctcaagc tgctctagca ttcgccattc aggctgcgca actgttggga: 121 agggcgatcg gtgcgggcct cttcgctatt acgccagctg gcgaaagggg gatgtgctgc: 181 aaggcgatta agttgggtaa cgccagggtt ttcccagtca cgacgttgta aaacgacggc infant newborn developmentWebLxiyu 6 Pack Pool Filter for Type I Filters Pump, Compatible with Bestway 58093 Filter,for Spa Filter Pool Pump Flowclear 58381 58511e 300/330 Gal/H (220-240 V) 4.5 (99) $2199. … infant newborn clothesWebpHSE401 (Plasmid #62201) Print Enlarge View all sequences Purpose CRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA … infant newborn mouseWebDownload scientific diagram 4: Egg cell-specific promoter-controlled CRISPR/Cas9 binary vector pHEE401E: Two sgRNA expression cassettes pHEE401E vector was used to create … infant newsboy hat